Juegos online

losmas   politica   contacto   acerca   facebook

buy online autodesk revit 2016 avid sibelius 7.5 cheap corel videostudio x6
nik software color efex pro 4 complete mac discount code 
price for adobe audition cs5.5 mac student rates 
  • click for info autodesk creation suite premium 2012
  • Si siempre quisiste saber como nace un bebe o convertirte en un medico de partos obstetra ahora tienes los juegos de atender partos de bebes de con los que podrás empezar a atender partos de bebes en los que aprenderás mucho sobre este trabajo de los juegos de atender partos de bebes gratis y los juegos de atender partos de bebes para jugar.

    juegos de atender partos de bebes

    juegos de atender partos de bebes

    Muchas mujeres dan a luz a diarios en muchas partes del mundo, en los juegos de atender partos de bebes el objetivo será atender esos partos de estas señoras que están por parir y que deciden venir a nuestro hospital. Cuando una de ellas venga tendrás que ver cuanto tiempo lleva de embarazo y cuando ha sido la última vez que se ha realizado un estudio, si necesita hacer el parto ahora mismo tendrás que empezar con el primer nacimiento de un bebe en los juegos de obstetricia gratis.

    Cada bebe que nazca con éxito y sano sumara nueva puntuación en tu perfil de medico de los juegos de atender partos de bebes. Consigue ser el mejor medico del hospital con un perfil impecable de nacimientos con éxito y bebes sanos que has dado a luz en su sala. Cuanto más éxito tengas, las mujeres de la ciudad querrán ser atendidas por ti y que su bebe nazca con la precisión y delicadeza que necesita. Recuerda que para hacer bien un parto primero tendrás que leer los tutoriales de cómo hacerlo.

    Cuando hayas conseguido leer con detenimientos lo tutoriales de nacimiento de un bebe podrás empezar los partos en los juegos de atender partos de bebes.

    Comparte con tus amigos!Share on FacebookTweet about this on Twitter

    Juegos Relacionados:

    Juegos de bebes naciendo
    Juegos de curar heridas graves gratis
    Juegos de tener mi propio bebe virtual gratis
    Juegos con bebes 11 meses
    Juegos con bebes en español
    Juegos de bebes divertidos para jugar online
    Juegos de cambiar bebes de ropa
    Juego virtual de tener bebes

    167 Comentarios

      Es facil.. le das a compartir en facebook o twitter diciendo cual es tu personaje favorito o que opinas sobre el juego y ya te sale 😀

      • mi bebe se llama poly


          • juego divertido

            • me gustaaa

            • a mi tambieeeeeeeeeeeeeeen

            jeje muchas grasias 😛

          • es hermosa mi bebeeee

            • No esta mal

            gas de juego

          que bello nombre

        • que ermoso nombre

        • la mia greici

        esta bueno..!

      • es super entretenido 🙂

      • que bonitos los bebes 😀

        • ni tanto

        yo jugue este y me gusto, los demas mas o menos pero este es genial jueguenlo ya veran

        • hola el juego es divertido

        me gusta atender a mi bebesitoo

      • gracias a los de la pagina por ponerlo 😀

      • me gussssta

      • esta bien que por fin este en español! gracias por compartir

      • hola amigos, jueguen este porque es el mejor

      • a mi me encanta

      • Me encanta que tengan juegos tan variados y ademas tanto online como para descargar. Muchas gracias por tomarse el tiempo de ponerlos para que podamos jugar todos, lo comparto! 😀

      holaaaaaaaaaaaaaaaaaa ^^

    • lo maximo

    • jajajajajajaj

    • lo mejor es cuando el bebe se pone a llorar jaja

      • gracias amigos

      • es muy emocionante este juego

      me gusto jugarloo

    • hola como hacen para poner el juego

      • este es mejor

        • me encantaaa

        a mi es el que mas me gusta 😀

      maadre mia, como mola este juego

    • buah es super real jaja

    • aprendes un monton ademas de medicina

    • es muy bueno

      • sii finoo

      ME GUSTO XD 🙂

    • ME GUSTO

    • un juego muy bueno

    • y ademas se puede descargar osea que genial

    • uy ese juego es tentador

    • este juego me da cosilla…pero esta muy bien hecho

      • como consigo los tutoriales

      alguien quiere jugar al modo multijugador conmigo?

    • mi novio me dejo

    • es muy buen juego

    • que bonito cuando nacen

    • muy muy entretenido

    • divertido, es uno de los mejores

    • lindisimo:darly

    • juju ste juego sta chido guey

    • q bacano juego cuando cresca sere medica

    • hola, es muy buen juego!

    • me gusta este juego es mi preferido

    • es una pasada guauauauauauauauauauaua

    • Es bastante divertido el juego 🙂

    • es de los mejores

    • ola

    • muuyyy way 😀

    • me gusta

    • me gusta

    • este guego como de guega pero yo creo que es muy diver tido me lo ima gino ggggg quiero saver el futuro por que esi yo quedo en varasada en el futuro quiero que mi parto me va ayudar mi ermano

      • muy way

      es uno de los mejores juegos de la pagina

    • este juego esta muy bueno 😀

    • es el que mas me gusta de todos los juegos 🙂

    • es mui bonito son los niños

    • olas me pueden explicar como se hace una vez tienes al bebe en la mano

    • es bien padre

    • megusta por q los doctores le ven el sapoooooooo.

    • me encanta este juegoo!

    • muy buen juego

    • ese juego es vacanisimo

    • esta padre el juego

    • me gusta 😀

    • es super facil este juego

    • muy way

    • quiero un novio ya

      • no cres que es muy teprano

      muy entretenido 🙂

    • gracias por ponerlo porque me divierto todos los dias

    • es verdad yo tanvien me divierto

    • es verda yo tanvie me divierto

    • es un poco aburrido

    • muy bueeno

      • excelente videojuego onlineee! gracias por ponerlo 😀

      muy bueno

    • esta muy bueno el juego esta super buen juego

    • esta muy bueno el juego

    • me gusta mucho el juego de bebes

    • es bueno

    • me encanta jugar♥♥♥♥♥♥

    • me encanta

    • esta rre piola el juego

    • este juego es para mi de los mejores

    • guacala

    • excelente, el mejor de todoos

    • meencantaa

    • me siento toda una doctora

    • me gusta atender partos 😀

    • es lo mejor este juego

    • holissssssssss jajaja

    • hola

    • este es el mejor de toda la pagina!

      • tampoco seas tan exagerada

      • me gusta mucho este guegoooooooooooooooooooooooooooooooooooooooooooooooooooooooooo


    • 😀

    • amo esta pagina <3 😀

    • este juego no acaba nunca 😀

    • eeeste es el que queria, por fin! graciass

    • Desde que lo empece no puedo paraaarr jajajaja no solo un poco mas y lo dejo hasta mañana. gracias por ponerlo

    • recomendado 🙂

    • mama mia! este juego es de lo mejor!

      • que geniaal

      estos juegos son de lo mejooorr

    • grandee! por fin este juego online!

    • que bueeeeeeeno 😀

      • es el mejor

      gracias gracia graciass! es el que queria

    • esta bien que por fin este en español! gracias por compartir

    • esta bien que por fin este en español! gracias por compartir

    • me gusta este juego

    • los amo valen 10000000000000000


    • que juego chido jajajajajejejeje

    • uuuuuse los recomiento

    • Gracias por ponerlo! me encanta la pagina sigan asii ♥

    • Juegos como este son los que me gustan 😀

    • me gusta mucho el juego 😀

    • este juego esta chido

    • Gracias por subirlo! 😀

      • Es justamente el que buscaba y encima esta en español! muchas gracias! los amoo!


    • hola seamos amigos y en que escuela estas

    • gracias otra vez

    • que grandee

    • jaja me encanta este juego

    • MG

    • me gusta mucho este juego 😀

    • este juego es lo mejor del mundo

    • Ya lo habia jugado pero no sabia que estaba online.. graciaasss

    • es lo mass

    • buenazo re massa

    • buenas tardes

      • hola

      • hola

      hello how are you? i love game

    • Muy bueno

    • graciaas

    • me gusta mucho, ademas es de los mejores que he visto

    • Estos juegos me encantan, y hasta me e hecho twitter por que no tenia y lo he compartido tambien!!!

    • Holaaa 😀

    • Me gustaaa mucho este juego! gracias por ponerlo amigooss

    • son los mejoress

    • muy buen juego

    • GRACIAS!! Este juego es el que estaba buscando 😀 mis 5 estrellass

    • muy bueno

    • lindote

    Añadir un comentario